View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4483_low_15 (Length: 238)
Name: NF4483_low_15
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4483_low_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 1458817 - 1459039
Alignment:
| Q |
1 |
tagaaaggcattgcataagcaagaagaaattgaacaaaccataaagccactcttcaagcctccaaatcggttgtggcttcaatggttgccacagggaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1458817 |
tagaaaggcattgcataagcaagaagaaattgaacaaaccataaagccactcttcaagcctccaaatcggttgtggcttcaatggttgccacagggaagt |
1458916 |
T |
 |
| Q |
101 |
ccttatagaacacttcaaaatcttactccaggaaaagtgaaaataatcatgacattgttattttgtttcg--atgttatcctaattaaaagcagaatttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
1458917 |
ccttatagaacacttcaaaatcttactccaggaaaagtgaaaataatcatgacattgttattttgtttcgatatgttatcctaattaaaagcagtatttt |
1459016 |
T |
 |
| Q |
199 |
accaaaactagaactgagttttc |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1459017 |
accaaaactagaactgagttttc |
1459039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University