View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4483_low_8 (Length: 297)
Name: NF4483_low_8
Description: NF4483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4483_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 25 - 106
Target Start/End: Complemental strand, 52548911 - 52548830
Alignment:
| Q |
25 |
accacggtttcacactaaagtataaatgnnnnnnnaaatcaaaatcaaattcatttaacacatacaaaccacattcgtctct |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52548911 |
accacggtttcacactaaagtataaatgtttttttaaatcaaaatcaaattcatttaacacatataaaccacattcgtctct |
52548830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 205 - 270
Target Start/End: Complemental strand, 52548809 - 52548744
Alignment:
| Q |
205 |
ttgaggtgtctatcgaacaatttcaacaaactaacttgccaatgacaaatatattgacatcagccc |
270 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
52548809 |
ttgaggtgtctatcgagcaatttcaacaaactagcttgccagtgacaaatatattgacatcagccc |
52548744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University