View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4484-Insertion-3 (Length: 218)
Name: NF4484-Insertion-3
Description: NF4484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4484-Insertion-3 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 218
Target Start/End: Original strand, 43180207 - 43180418
Alignment:
| Q |
7 |
acaaacattattatttcttgttgcaatggcatcatttaaagctcatctttcggaagtgaactttttgttgggtttttagatgactttttgattggatagg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43180207 |
acaaacattattatttcttgttgcaatggcatcatttaaagctcatctttcggaagtgaactttttgttgggtttttagatgactttttgattggatagg |
43180306 |
T |
|
| Q |
107 |
aagcctccatagctatgccacatagaccttgcttatgagatatggccccttgcattctaatgtaaccctgttctccccattcacttccccaagagttctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43180307 |
aagcctccatagctatgccacatagaccttgcttatgagatatggccctttgcattctaatgtaaccctgttctccccattcacttccccaagagttctt |
43180406 |
T |
|
| Q |
207 |
cactgtccaata |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43180407 |
cactgtccaata |
43180418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University