View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4484_high_10 (Length: 240)

Name: NF4484_high_10
Description: NF4484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4484_high_10
NF4484_high_10
[»] chr3 (1 HSPs)
chr3 (8-83)||(13403072-13403147)


Alignment Details
Target: chr3 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 13403072 - 13403147
Alignment:
8 ttattattaattttgatgagtgtttgtataaagtttaattatgactagccctttttacgggctttaataattagtc 83  Q
    |||||||||||||| |||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||    
13403072 ttattattaatttttatgattttttgtataaagtttaattttgactagccctttttacgggctttaataattagtc 13403147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University