View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4484_high_5 (Length: 386)
Name: NF4484_high_5
Description: NF4484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4484_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 211; Significance: 1e-115; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 3 - 262
Target Start/End: Original strand, 42899172 - 42899433
Alignment:
| Q |
3 |
tctccaatgcaactctatagtctcaagatcatgattatttaaaa--ttgttattgttcatgtttcaagaattatttatcagtaatctttacctttcacct |
100 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||||| || || |||||| ||||||||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
42899172 |
tctccaatgcaactctatcgtctcaaggtcatgattatttaaaaaattcttgttgttcctgtttcaagtattatttatcaatcatctttacctttcacct |
42899271 |
T |
 |
| Q |
101 |
tggaatactttagctatttgagacaagggaatgggttgttcacactttagctagaaaaccagagatccatccatccacgaaaacaaaatagaaacactga |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
42899272 |
tcgaatactttagctatttgagacaagggaatgggttgttcacactttagctagaaaaccagagatccatccatccacgaaaacaacatagaaacactga |
42899371 |
T |
 |
| Q |
201 |
tcacaactgggcggaaaacgcagacggacttgctcatcgggcgcggttaacagtgagttcaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42899372 |
tcacaactgggcggaaaacgcagacggacttgctcatcgggcgcggttaacagtgagttcaa |
42899433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 303 - 380
Target Start/End: Original strand, 42899474 - 42899551
Alignment:
| Q |
303 |
tgtatctcgcacgaggatacaattccatcgcgatttgtgacgcaccagagcagagctccactacgcacttcatctcac |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42899474 |
tgtatctcgcacgaggatacaattccatcgcgatttgtgacgcaccagagcagagctccactacgcacttcatttcac |
42899551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 239
Target Start/End: Complemental strand, 19386543 - 19386499
Alignment:
| Q |
195 |
cactgatcacaactgggcggaaaacgcagacggacttgctcatcg |
239 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||||||||||| |
|
|
| T |
19386543 |
cactgatctcaactgcccggaaaacgcagacgaacttgctcatcg |
19386499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University