View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486-Insertion-3 (Length: 309)
Name: NF4486-Insertion-3
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486-Insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 89; Significance: 7e-43; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 24004677 - 24004554
Alignment:
| Q |
18 |
tccgttgagcttgagcttgaaaataactttcagatctcacattggtgctttgatttaaagagttattaggtaaagtgctccaaaagcatgtccaaaacat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
24004677 |
tccgttgagcttgagcttgaaaataactttcagatctcacattggtgctttgatttaaagagtaattaggtaaagt-------atgcatgtccaaaacat |
24004585 |
T |
|
| Q |
118 |
aacatgcatccaagaaacaaataaattatct |
148 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |
|
|
| T |
24004584 |
aacatgcattcaagaaacaactaaattatct |
24004554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 234 - 309
Target Start/End: Complemental strand, 24004401 - 24004333
Alignment:
| Q |
234 |
gtaaattaactgattgtctcatccatcaacccctaggccctaaccaaacttcctgtgatatcaaatgcttttcccc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24004401 |
gtaaattaactgattgtctcatccatcaa-------gccctaaccaaacttcctgtgatatcaaatgcttttcccc |
24004333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 92 - 146
Target Start/End: Complemental strand, 24013096 - 24013041
Alignment:
| Q |
92 |
gtgctccaaaagc-atgtccaaaacataacatgcatccaagaaacaaataaattat |
146 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24013096 |
gtgctccaaaagccatgtccaaaacataacatgcatccaagaaacaaataaattat |
24013041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 9 - 94
Target Start/End: Complemental strand, 24013214 - 24013129
Alignment:
| Q |
9 |
aaatcacagtccgttgagcttgagcttgaaaataactttcagatctcacattggtgctttgatttaaagagttattaggtaaagtg |
94 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||| |||||| |||||||||| |||| ||| |||| ||||||| |
|
|
| T |
24013214 |
aaatcacagtccgttgagcttgagctggaaaataacgttcagatgtcacatcagtgctttgatctaaaaagtaattaaataaagtg |
24013129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 201 - 268
Target Start/End: Complemental strand, 24012841 - 24012774
Alignment:
| Q |
201 |
gaaaatggcaaaaggtaaattaactgctagaaagtaaattaactgattgtctcat-ccatcaaccccta |
268 |
Q |
| |
|
||||||||||||| |||||||||| | |||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
24012841 |
gaaaatggcaaaatataaattaactcccagaaagtaaatt-actgattgtctcatcccatcaaccccta |
24012774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 110 - 148
Target Start/End: Complemental strand, 23997688 - 23997650
Alignment:
| Q |
110 |
caaaacataacatgcatccaagaaacaaataaattatct |
148 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
23997688 |
caaaacaaaacatgcatccaaaaaacaaataaattatct |
23997650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University