View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486-Insertion-4 (Length: 309)
Name: NF4486-Insertion-4
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486-Insertion-4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 8 - 309
Target Start/End: Complemental strand, 48430585 - 48430284
Alignment:
| Q |
8 |
aacaggtggccaggggaaaggcaattttggctagtgcaagggaacttgaggatgaattatttggagagatgcaagcagttggaggctgagttacataaag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
48430585 |
aacaggtggccaggggaaaggcaattttggctagtgcaagggaacttgaggctgaattatttggagagatgcaaacagttggaggctgagttacatgaag |
48430486 |
T |
|
| Q |
108 |
ggtgtcagaatagtcaactgatggggtcgtttgccaatgcattttacacaggagctcccaccgtgaaccccgttgtcttctttccttcattagtatattt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48430485 |
ggtgtcagaatagtcaactgatggggtcgtttaccaatgcattttacacaggagctcccaccgtgaaccccgtcgtcttctttccttcattagtatattt |
48430386 |
T |
|
| Q |
208 |
tannnnnnnataactcctattagtttttagatgtcccatttaaaggactgttcatacactcttgttcaaaaaaggtctgttcatacactgctttgtgtct |
307 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48430385 |
tatttttttataactcctattggtttttagatgtcccatttaaaggactgttcatacactcttgttcaaaaaaggtctgttcatacactgctttgtgtct |
48430286 |
T |
|
| Q |
308 |
ag |
309 |
Q |
| |
|
|| |
|
|
| T |
48430285 |
ag |
48430284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University