View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486_high_13 (Length: 268)
Name: NF4486_high_13
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486_high_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 3121515 - 3121268
Alignment:
| Q |
19 |
aaaagggtggtaaactttttcctgcaagtgactatgggaaagaggaaaagaaaaaggtgcacaagttgaattgaatttttggatttcctgattccttttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3121515 |
aaaagggtggtaaactttttcctgcaagtgactatgggaaagaggaaaagaaaaaggtgcacaagttgaattgaatttttggatttcctgattccttttg |
3121416 |
T |
|
| Q |
119 |
ttgggaagcatccaagtgaacctaacttttatgttatatatgtgtagttgctttctgtgtc---------acattatcgtagaccatggtttgtgaggaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3121415 |
ttgggaagcatccaagtgaacctaacttttatgttatatatgtgtagttgctttctgtgtcattattaatacattatcgtagaccatggtttgtgaggaa |
3121316 |
T |
|
| Q |
210 |
aattattgtagttgtaaaagtactgtaatcgtattagggtttagtatt |
257 |
Q |
| |
|
||| |||||||||| ||||||| ||||||||| || |||||||||| |
|
|
| T |
3121315 |
aataattgtagttgcaaaagtataataatcgtataagagtttagtatt |
3121268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University