View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486_high_19 (Length: 242)
Name: NF4486_high_19
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 4 - 224
Target Start/End: Complemental strand, 40839535 - 40839315
Alignment:
| Q |
4 |
tggtctatttccatcagcaaatttctacctcaccccttgaaacctgaggaagatgagatttatttgctttggcttttttgtcatccagataatgttgata |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40839535 |
tggtctatttccatcagcaaatttctacctcaccccttgaaacctgaggaagatgagattcatttgctttggcttttttgtcatctagataatgttgata |
40839436 |
T |
|
| Q |
104 |
aatataggaaagaaatccccatattgctaacatcaaagctataaacttcaccccattaattttgtcatggaagaaaataacagcaaggataggacctaca |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839435 |
aatataggaaagaaatccccatattgctaacatcaaagctataaacttcaccccattaattttgtcatggaagaaaataacagcaaggataggacctacg |
40839336 |
T |
|
| Q |
204 |
ggaagtaccactgtacctatt |
224 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40839335 |
ggaagtaccactgtacctatt |
40839315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 190
Target Start/End: Original strand, 4582640 - 4582758
Alignment:
| Q |
72 |
ttggcttttttgtcatccagataatgttgataaatataggaaagaaatccccatattgctaacatcaaagctataaacttcaccccattaattttgtcat |
171 |
Q |
| |
|
|||||||||||||| || | ||||| |||||||||||| |||| ||||||||||||||||| ||||| |||||| | || ||||||| ||| ||||||| |
|
|
| T |
4582640 |
ttggcttttttgtcgtctaaataattttgataaatatatgaaaaaaatccccatattgctattatcaaggctatagatttgaccccatcaatcttgtcat |
4582739 |
T |
|
| Q |
172 |
ggaagaaaataacagcaag |
190 |
Q |
| |
|
||||||| | ||||||||| |
|
|
| T |
4582740 |
ggaagaacaaaacagcaag |
4582758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University