View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486_high_27 (Length: 214)
Name: NF4486_high_27
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486_high_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 17 - 197
Target Start/End: Original strand, 31330269 - 31330449
Alignment:
| Q |
17 |
aacaagtacttgctcagcacttatggtttcaagtaccctatttttcttaccatgtgtcatatgatagcgtgttctttatttagttatgtagctatagtat |
116 |
Q |
| |
|
|||||||| ||| | |||| |||||||||||||| ||||||||||| |||||||||||||||| |||||||||||| ||||| ||||| ||||||| || |
|
|
| T |
31330269 |
aacaagtatttgttaagcaactatggtttcaagtatcctatttttctcaccatgtgtcatatgacagcgtgttctttgtttagctatgttgctatagcat |
31330368 |
T |
 |
| Q |
117 |
cgataaagcttgttcctatgcaaactattcaatctaggattcaattctttaagatctctgctttgagtttgattttctgtg |
197 |
Q |
| |
|
||| ||| ||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31330369 |
ggatgaagattgttcctatgcaaactattcgatccagggttcaattctttaagatctctgctttgagtttgattttctgtg |
31330449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 197
Target Start/End: Original strand, 35016212 - 35016253
Alignment:
| Q |
156 |
ttcaattctttaagatctctgctttgagtttgattttctgtg |
197 |
Q |
| |
|
||||||||||||||||| || |||||||||| |||||||||| |
|
|
| T |
35016212 |
ttcaattctttaagatcgctactttgagttttattttctgtg |
35016253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University