View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486_high_9 (Length: 362)
Name: NF4486_high_9
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 16 - 351
Target Start/End: Complemental strand, 42217197 - 42216862
Alignment:
| Q |
16 |
catagtgcatacaaatgcaaggttgatttgatttaaacttgttttcttgtgcagcaaggtgataggagcaaaatacttcaacctcgacccatctggtcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42217197 |
catagtgcatacaaatgcaaggttgatttgatttaaacttgttttcttgtgcagcaaggtgataggagcaaaatacttcaacctcgacccatctggtcca |
42217098 |
T |
 |
| Q |
116 |
accatcgagaacccaagtccggttgatgatcagggccatggcactcacacttcgtcgacagcggctggatcagtggtgaggggtgcaagtctttatggca |
215 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42217097 |
accatcgagaacccaagtccggtggatgatcagggccatggcactcacacttcgtcgacagcagctggatcagtggtgagaggtgcaagtctttatggca |
42216998 |
T |
 |
| Q |
216 |
ttggtaaaggcaatgcccgtggcggtgtcccatcagcacgtattgcaatgtataaagtttgttggaccattgggtgcagtgacatggacatgcttgctgg |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216997 |
ttggtaaaggcaatgcccgtggcggtgtcccatcagcacgcattgcaatgtataaagtttgttggaccattgggtgcagtgacatggacatgcttgctgg |
42216898 |
T |
 |
| Q |
316 |
ctttgatgaggccattgctgatggtgtcaacttcat |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42216897 |
ctttgatgaggccattgctgatggtgtcaacttcat |
42216862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University