View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4486_low_24 (Length: 240)
Name: NF4486_low_24
Description: NF4486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4486_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 40859698 - 40859466
Alignment:
| Q |
1 |
ccaacttctcaaatgaaggtaagaagactgattacttagcttccctacaacttacaattactggggtaatatttttaccttgtaagtttgcaacagaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859698 |
ccaacttctcaaatgaaggtaagaagactgattacttagcttccctacaacttacaattactggggtaatatttttaccttgtaagtttgcaacagaata |
40859599 |
T |
|
| Q |
101 |
ctgttgtagttttggtgagtataatttgttaaagtaaacttgtgctattgtagat---------aactatat-atgagcttaaatagaagctcaataact |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| | |||||||||||||||||||||||||| |
|
|
| T |
40859598 |
ctgttgtagttttggtgagtataatttgttaaagtaaacttgtgctattgtagatggttttaagacttatctggtgagcttaaatagaagctcaataact |
40859499 |
T |
|
| Q |
191 |
atatatgagcaatttcagaatggggtcttatat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
40859498 |
atatatgagcaatttcagaatggggtcttatat |
40859466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University