View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4487-Insertion-4 (Length: 251)
Name: NF4487-Insertion-4
Description: NF4487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4487-Insertion-4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 2587659 - 2587436
Alignment:
| Q |
8 |
ataatcattttattttctcttttgaataataataaaagttattactataacttataatcattgttgagcttgatcttatcgcttttcaataatttcaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
2587659 |
ataatcattttattttctcttttgaataataataaaagttatta---taacttataatcattgttgagcttgatcttatcacttttccataatttcaaca |
2587563 |
T |
|
| Q |
108 |
caaataagacctgcacttatttttccggacccgtgtggaccactaacagagaagatcgacgagtgagtggtgacatagagaggaaatgggcatgtatgat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587562 |
caaataagacctgcacttatttttccggacccgtgtggaccactaacacagaagatcgacgagtgagtggtgacatagagaggaaatgggcatgtatgat |
2587463 |
T |
|
| Q |
208 |
gcttagatatatcaatgtggtagcact |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2587462 |
gcttagatatatcaatgtggtagcact |
2587436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University