View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4487_high_3 (Length: 343)
Name: NF4487_high_3
Description: NF4487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4487_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 103 - 335
Target Start/End: Original strand, 45340390 - 45340622
Alignment:
| Q |
103 |
gtaatcacatgtatccgttttattggcgtcgaacactaacacacttttcatcagaaatattggtgctacaaacccatcttttcnnnnnnnnnnnnnnnnn |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45340390 |
gtaatcacatgtatccgttttattggcgtcgaacactaacacacttttcatcagaaatattggtgctacaaacccatcttttcttatattattattatta |
45340489 |
T |
|
| Q |
203 |
nnnnnggaaaaccttattaggggtgctaaaactatcatatatgagatttagcaacatttttcaaatgttactaaccnnnnnnntactacttaacatttaa |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45340490 |
ttattggaaaaccttattaggggtgctaaaactatcatatatgagatttagcaacatttttcaaatgttactaaccaaaaaattactacttaacatttaa |
45340589 |
T |
|
| Q |
303 |
taacatttgaaaatgttaggcaaaacctatgct |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
45340590 |
taacatttgaaaatgttaggcaaaacctatgct |
45340622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 5 - 69
Target Start/End: Original strand, 45340292 - 45340356
Alignment:
| Q |
5 |
ggtatcttatttacaaattattaatatagacatagacacaacattgatacaaacatgttgacaac |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45340292 |
ggtatcttatttacaaattattaatatagacatagacacaacattgacacaaacatgttgacaac |
45340356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University