View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4487_high_9 (Length: 237)
Name: NF4487_high_9
Description: NF4487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4487_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 3447956 - 3448176
Alignment:
| Q |
1 |
aaatgattagcaacatttgtccacttctctgactcttaagatgttgaagcagttggtcgtcccaattgatcaattatattgtcttctgtaagaattattg |
100 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3447956 |
aaatgactagtaacatttgtccacttctctgactctgaagatgttgaagcggttggtcgtcccaattgatcaattatattgtcttctgtaagagttattg |
3448055 |
T |
|
| Q |
101 |
atcattgttagtattctgcaaggaactttctacgggcatggtacgaaccaatacctagcggccatcatggtctaaagggaagctcacttcttctctcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3448056 |
atcattgttagtattctgcaaggaactttctacgggcatggtacgaaccaatacctagcggccatcatggtctaaagggaagctcacttcttctctcatg |
3448155 |
T |
|
| Q |
201 |
cttctgatggatctagcaaag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3448156 |
cttctgatggatctagcaaag |
3448176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 16775297 - 16775395
Alignment:
| Q |
123 |
gaactttctacgggcatggtacgaaccaatacctagcggccatcatggtctaaagggaagctcacttcttctctcatgcttctgatggatctagcaaag |
221 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16775297 |
gaactttctacaggcatggtacgaaccagtccctagcggccatcatggtctaaagggaggctcacttcttctctcatgcttctgatggatctagcaaag |
16775395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University