View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4487_low_11 (Length: 206)
Name: NF4487_low_11
Description: NF4487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4487_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 1005182 - 1005009
Alignment:
| Q |
15 |
atgaagatataaaagaaaagaaagaaagactagaatcaaacctttggaggccttcttatcatttgttccattatcgacaatgatttagtgaacacatcct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1005182 |
atgaagatataaaagaaaagaaagaaagactagaatcaaacctttggaggccttcttatcatttgttccattatcgacaatgatttagtgaacacatcct |
1005083 |
T |
 |
| Q |
115 |
tattgcatatctgggaagtacttttggccgctggaggtttgattataggttctgttaagatttgaccctgtatg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1005082 |
tattgcatatctgggaagtacttttggccgctggaggtttgattataggttctgttaagatttgaccctgtatg |
1005009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 40 - 106
Target Start/End: Complemental strand, 52473324 - 52473258
Alignment:
| Q |
40 |
aagactagaatcaaacctttggaggccttcttatcatttgttccattatcgacaatgatttagtgaa |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||| ||| | ||||||||| ||||| |
|
|
| T |
52473324 |
aagaccagaatcaaacctttggaggccttcttattatttgttccgttaacagcaatgatttggtgaa |
52473258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 44 - 75
Target Start/End: Original strand, 21223399 - 21223430
Alignment:
| Q |
44 |
ctagaatcaaacctttggaggccttcttatca |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21223399 |
ctagaatcaaacctttggaggccttcttatca |
21223430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University