View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4488-Insertion-11 (Length: 339)
Name: NF4488-Insertion-11
Description: NF4488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4488-Insertion-11 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 229 - 339
Target Start/End: Complemental strand, 428167 - 428057
Alignment:
| Q |
229 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428167 |
tacttgctcaggccactcagaagaaatttcggacatcaactcaatgattttactgctgatgacattcaatattttaccaatgacttgtgtcatacgtaag |
428068 |
T |
 |
| Q |
329 |
tatttgatccc |
339 |
Q |
| |
|
||||||||||| |
|
|
| T |
428067 |
tatttgatccc |
428057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University