View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4488_high_10 (Length: 248)
Name: NF4488_high_10
Description: NF4488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4488_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 31 - 238
Target Start/End: Complemental strand, 40237128 - 40236923
Alignment:
| Q |
31 |
atttctgtctcaatatattcgtgtgggaatcaaaaaggtagnnnnnnnnnnnngaaggaataggtgaaaactaaccgaagcaccttactcgattgaaata |
130 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40237128 |
atttctgtctcaatatattcatgtgggaatcaaaagggtagtttttttttta--aaggaataggtgaaaactaaccgaagcaccttactcaattgaaata |
40237031 |
T |
|
| Q |
131 |
cgatctaataaatttcattcctaaaacttctttccggtcttttatcagcaccgtaatgtttgtggaactgcaaagaattttttgagtttacaatagttcc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40237030 |
cgatctaataaatttcattcctaaaacttctttccggtcttttatcagcaccgtaatgtttgtggaactgcaaagaattttttgagtttacaatagctcc |
40236931 |
T |
|
| Q |
231 |
ggcctttg |
238 |
Q |
| |
|
||| |||| |
|
|
| T |
40236930 |
ggcttttg |
40236923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 1488400 - 1488346
Alignment:
| Q |
17 |
ttcaacatagaggaatttctgtctcaatatattcgtgtgggaatcaaaaaggtag |
71 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||| | ||||||||||||| ||||| |
|
|
| T |
1488400 |
ttcagcatagaggaatttctatctcaatatattggggtgggaatcaaaagggtag |
1488346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University