View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4488_low_6 (Length: 331)
Name: NF4488_low_6
Description: NF4488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4488_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 10 - 316
Target Start/End: Original strand, 28488227 - 28488536
Alignment:
| Q |
10 |
attattctcgaccataaccttgttctcaaccttgcttatctcagttatttggctttcttctttttcctttagttgtatcttgagtttattagtgatctct |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28488227 |
attattctcgaccataaccttgttctcaaccttgcttatctcagttatttggctttcttctttttcctttagttgtatcttgagtttattagtgatctct |
28488326 |
T |
|
| Q |
110 |
tgcttcttctccaccttctcgtcataagcttgcaatgatccttgaattgttttattgtcatggttcacagcaatatgctcaaacttgggatccacaggtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
28488327 |
tgcttcttctccaccttctcgtcataagcttgcaatgatccttgaattgttttattgtcatggttcacaacagtatgctcaaacttgggatccacaggtg |
28488426 |
T |
|
| Q |
210 |
tattatctt---cataatgatagcatcttctaacttctacccattcctttaattcattgaaatatgatagctcttgaaaaatattcaaaaatagatcctg |
306 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28488427 |
tattatcttctccataatgatagcatcttctaacttctatccattcctttaattcattgaaatatgatagctcttgaaaaatattcaaaaatagatcctg |
28488526 |
T |
|
| Q |
307 |
agtctttcat |
316 |
Q |
| |
|
||||| |||| |
|
|
| T |
28488527 |
agtctatcat |
28488536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University