View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4488_low_8 (Length: 318)
Name: NF4488_low_8
Description: NF4488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4488_low_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 52751065 - 52750748
Alignment:
| Q |
1 |
tttcgattcattttttgaatctcgatttgataaccatggttgccacaaacttttaagcccatgcaaaaactcattttaccatcgatttgaatgttttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
52751065 |
tttcgattcattttttgaatctcgatttgataaccatggttgccacaaacttttaagcccatgcaaaaactcattttaccctcgatttgaatgttttact |
52750966 |
T |
 |
| Q |
101 |
gatatgtaacaatttcggggccagtcaccaccatgtgccattatccaggattgattactaggttctaaatcaaaacatttccatatttaaaggattgctt |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52750965 |
gatatttaacaatttcggggccagtcaccaccatgtgccattatccaggattgattactaggttctaaatcaaaacatttccatatttaaaggattgctt |
52750866 |
T |
 |
| Q |
201 |
attagttattatatatgatatgcgctattatgacattcatatttgttgactgtgcactaggagcaaatattcaacttgtagattcatcaccttatagtta |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52750865 |
attagttattatatgtgatatgcgctattatgacattcatatttgttgactgtgcactaggagcaaatattcaacttgtagattcatcaccttatagtta |
52750766 |
T |
 |
| Q |
301 |
actgcttctgattaaata |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52750765 |
actgcttctgattaaata |
52750748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University