View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4489_high_7 (Length: 250)
Name: NF4489_high_7
Description: NF4489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4489_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 20872106 - 20872346
Alignment:
| Q |
1 |
aaacatgtttggcagcatttgttgcaaaagaacaagcatggttttctatgatgagtctctgaacatcgataatcacatgcagcaccacattctgcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20872106 |
aaacatgtttggcagcatttgttgcaaaagaacaagcatggttttctatgatgagtctctgaacatcgataatcacatgcagcaccacattctgcaaaat |
20872205 |
T |
 |
| Q |
101 |
gtgtaattaaaaggatgttattaatgtttactattttctagttttgctttaattacaagcagtaaaagagtttg-aatttatagaattaagtttggatct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20872206 |
gtgtaattaaaaggatgttattaatgtttactattttctagttttgctttaattacaagctgtaaaagagtttgaaatttatagaattaagtttggatct |
20872305 |
T |
 |
| Q |
200 |
attaccttcttgaagaagtgatccctcataaccagcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20872306 |
attaccttcttgaagaagtgatccctcataaccagcctatg |
20872346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 102
Target Start/End: Complemental strand, 35408850 - 35408802
Alignment:
| Q |
54 |
agtctctgaacatcgataatcacatgcagcaccacattctgcaaaatgt |
102 |
Q |
| |
|
||||| ||||||||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
35408850 |
agtctttgaacatcgatgatcacaagcatgaccacattctgcaaaatgt |
35408802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 86
Target Start/End: Complemental strand, 9843613 - 9843546
Alignment:
| Q |
19 |
ttgttgcaaaagaacaagcatggttttctatgatgagtctctgaacatcgataatcacatgcagcacc |
86 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9843613 |
ttgttgcaaaaaaacaagcatggcttcatatgatgagtctgtgaacatcgataatcacatgcagcacc |
9843546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University