View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4489_low_5 (Length: 300)
Name: NF4489_low_5
Description: NF4489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4489_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 281
Target Start/End: Original strand, 31998035 - 31998315
Alignment:
| Q |
1 |
ctctgcataagaattggattttaatttgtttaatcaaagtcttttgacctatctcactctggagtaattagtttcttacctattggacaaatgagaaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31998035 |
ctctgcataagaattggattttaatttttttaatcgaagtcttttgacctatttcactctggagtaattagtttcttacctattggacaattgagaaata |
31998134 |
T |
|
| Q |
101 |
cattaattggagacaacactgtcaatcaactgttggctctcactctttggcgcattcggataaactgcaatgatagtgtattcaacaaaggtcagatcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31998135 |
cattaattggagacaacactgtcaatcaactgtttactctcactctttggcgcattcggataaactgcaatgatgttgtattcaacaaaggtcagatcca |
31998234 |
T |
|
| Q |
201 |
tgctttaaaatcaagaagtgtctacttttgctgagcacttcaatcaatttgcaaaatccgagcctgcagcaagagtatatc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31998235 |
tgctttaaaatcaagaagtgtctacttttgctgagcacttcaatcaatttgcaaaatccgagcctgcagcaagagtatatc |
31998315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University