View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4489_low_6 (Length: 297)
Name: NF4489_low_6
Description: NF4489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4489_low_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 94 - 297
Target Start/End: Original strand, 42870384 - 42870587
Alignment:
| Q |
94 |
acagattccttaattcggcataatctgctgcattctcaaatccaattactaattgtggattctgttctttcttgtcttaaatatctgctaaactatgggt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42870384 |
acagattccttaattcggcataatctgctgcattctcaaatccgattactgattgtggattctgttctttcttgtcttaaatatctgctaaactatgggt |
42870483 |
T |
|
| Q |
194 |
aactggtgtgcttactatatgatgttttgcgttttaactgcagagtggtagcaaggccaaacctggtaaagatcagtcaactgagcgccctgctgattgc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42870484 |
aactggtgtgcttactatatgatgttttgcgttttaactgcagaggggtagcaaggccaaacctggtaaagatcagtcgactgagcgccctgctgattgc |
42870583 |
T |
|
| Q |
294 |
aagc |
297 |
Q |
| |
|
|||| |
|
|
| T |
42870584 |
aagc |
42870587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University