View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4490-Insertion-11 (Length: 135)
Name: NF4490-Insertion-11
Description: NF4490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4490-Insertion-11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 9e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 9e-65
Query Start/End: Original strand, 6 - 134
Target Start/End: Complemental strand, 15980315 - 15980187
Alignment:
| Q |
6 |
catttggaagtgagatttataccattagaaagtagacaaaattacatacggtatacacacaccaaatgtataactccattgagtagaatatgatcaatcc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15980315 |
catttggaagtgagatttataccattagaaagtagacaaaattacatacggtatacaaacaccaaatgtataactccattgagtagaatatgatcaatcc |
15980216 |
T |
 |
| Q |
106 |
tagatgcaagatcgataaaaatgtttgcc |
134 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15980215 |
tagatgcaagatcgataaaaatgtttgcc |
15980187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University