View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4490-Insertion-9 (Length: 195)
Name: NF4490-Insertion-9
Description: NF4490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4490-Insertion-9 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 8 - 195
Target Start/End: Complemental strand, 28604038 - 28603851
Alignment:
| Q |
8 |
atatctagcaagttgaaatgtctcttctatcttgtgagttctgatatatgggagagggaatttataagccttatatagagatagttatggagtgcagaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28604038 |
atatctagcaagttgaaatgtctcttctatcttgtgagttttgatatatgggagagggaatttataagccttatatagagatagttatggagtgcacaac |
28603939 |
T |
|
| Q |
108 |
tcaattaataatttaagcttaagtgtgccatttgggaagtgtaaaacaaaagcctaatttgggcggcacaatatccactactacgcaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28603938 |
tcaattaataatttaagcttaagtgtgccatttgggaagtgtaaaacaaaagcctaatttgggcggcacaatatccactactacgcaa |
28603851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University