View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4490_low_10 (Length: 228)
Name: NF4490_low_10
Description: NF4490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4490_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 24203232 - 24203009
Alignment:
| Q |
7 |
aaaatgtggcccggcaaaaagatcgcaagagttgggactgtactttgtgacgacctcttgaagcgagcaagctaatcatggtggacattgcagggatcaa |
106 |
Q |
| |
|
|||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24203232 |
aaaatgaggcccgacaaaaagatcgcaagagttgggactgtactttgtgacgacctcttgaagcgagcaagctaatcatggtgcacattgcagggatcaa |
24203133 |
T |
 |
| Q |
107 |
acaagacaatacgaacgcatgagagtccatgtaagaaaatattatcaacccgaagaagctattgcgggtacgtaatggttgatttacgccgaacccaaat |
206 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||| |||||||| |
|
|
| T |
24203132 |
acaggacaatacgaacacatgagagtccatgtaagaaaatattatcaacccgaagaagctattgcgggttcgtaagggttgatttatgccgtacccaaat |
24203033 |
T |
 |
| Q |
207 |
tct--aagtaccacattttatcat |
228 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
24203032 |
tctaaaagtaccacattttatcat |
24203009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University