View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4490_low_7 (Length: 255)
Name: NF4490_low_7
Description: NF4490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4490_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 37227583 - 37227357
Alignment:
| Q |
17 |
tgaacatgccaaatcaggtaaaacctcaatatcatttccatttggtgattgcgtagcttttgaacctaacggcgaaacaccatccaaatccttacttccc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37227583 |
tgaacatgccaaatcaggtaaaacctcaatatcatttccatttggtgattgcgtagcttttgaacctaacagcgaaacaccatccaaatccttacttccc |
37227484 |
T |
|
| Q |
117 |
tgtgccaaaattgcaaccaacttaggagagagtcttccataatcatgggtttttcttccttgttccccttcaatactcatagcatctgaatccccgctag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227483 |
tgtgccaaaattgcaaccaacttaggagagagtcttccataatcatgggtttttcttccttgttccccttcaatactcatagcatctgaatccccgctag |
37227384 |
T |
|
| Q |
217 |
cactcgccaacaccggcgactgaggcg |
243 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
37227383 |
cactcgccaccaccggcgactgaggcg |
37227357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University