View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4490_low_9 (Length: 237)
Name: NF4490_low_9
Description: NF4490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4490_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 40362723 - 40362931
Alignment:
| Q |
14 |
atgaatataatggttcttggtggtgaaattttgtaacgtaaaacagttgctgctttagcatgcatactgcgcactaatggagcgcaccatataaggtata |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40362723 |
atgaatataatggttcttggtagtgaaattttgtaacgtaaaacagttgctgctttagcatgcatactgcgcactaatggagcgcactatataaggtata |
40362822 |
T |
 |
| Q |
114 |
tacaacccttttacatcttcttttgctcttaataaagtaaagcatgaataagacactatgctttacggtttgtagagaaaatcaaaatcttttcataacc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
40362823 |
tacaacccttttacatcttcttttgctctcaacaaagtaaagcatgaataagacactatgctttgcggtttgtagagaaaatcaaaatcttttcatgacc |
40362922 |
T |
 |
| Q |
214 |
aaacttaat |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
40362923 |
aaacttaat |
40362931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University