View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4492-Insertion-8 (Length: 173)
Name: NF4492-Insertion-8
Description: NF4492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4492-Insertion-8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 8e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 8e-75
Query Start/End: Original strand, 7 - 152
Target Start/End: Original strand, 17492359 - 17492504
Alignment:
| Q |
7 |
agttttggtttgggtaaagcatgaaataaatgagcatatatatcaatcatcttttaggtaagctattgatatgtttaatcttcttttagtatgacatttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17492359 |
agttttggtttgggtaaagcatgaaataaatgagcatatatatcaatcatcttttaggtaagctattgatatgtttaatcttcttttagtatgacatttg |
17492458 |
T |
|
| Q |
107 |
ttagatcttccattgtctcaggtgaatgttgcaccccatgtaggta |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17492459 |
ttagatcttccattgtctcaggtgaatgttgcaccccttgtaggta |
17492504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University