View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4492_low_4 (Length: 334)
Name: NF4492_low_4
Description: NF4492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4492_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 27100957 - 27100643
Alignment:
| Q |
1 |
ttgttgattgagggagcgatatagtactgaaatgttgcaggcgagtggctaggtgaaaaggatatttaaaaataatagggggccaagtcatttagcttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27100957 |
ttgttgattgagggagcgatatagtactgaaatgttgcaggcgagtggctgggtgaaaaggatatttaaaaataatagggggccaagtcatttagcttta |
27100858 |
T |
 |
| Q |
101 |
acaattgtttaagggaacacaattttgaggaagtggtatattaggttttaacggtgggacttggtttcttcaaaacatgcccaagactattttgtttggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27100857 |
acaattgtttaagggaacacaattttgaggaagtggtatattaggttttaacggtgggactt-gtttcttcaaaacatgcccaagactatattgtttggt |
27100759 |
T |
 |
| Q |
201 |
gcatgaatataaatggtgggtaacctgaatcaatagatttgatattatattatgttttagtgttgatcattaggtttatctcgttcttataaaattggct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
27100758 |
gcatgaatataaatggtgggtaacctgaatcaatatatttgatattatattatgttttagtgttaatcattaggtttatctcattcttataaaatcggct |
27100659 |
T |
 |
| Q |
301 |
tataagatgaatgatg |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27100658 |
tataagatgaatgatg |
27100643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University