View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4492_low_5 (Length: 319)
Name: NF4492_low_5
Description: NF4492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4492_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 23870749 - 23870632
Alignment:
| Q |
1 |
tcaccttgaacgtgcgttcaattggttctaaacgctgaagcaaacacacacaaaatgatagttgtatatgatcattcctaaattattccttgttgggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870749 |
tcaccttgaacgtgcgttcaattggttctaaacgttgaagtaaacacacataaaatgatagttgtatatgatcattcctaaattattccttgttgggggt |
23870650 |
T |
 |
| Q |
101 |
gagggtcatttttgtatg |
118 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
23870649 |
gagggccatttttgtatg |
23870632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 175 - 311
Target Start/End: Complemental strand, 23870628 - 23870492
Alignment:
| Q |
175 |
aattatgttcatctatatttagtgtgatatttactttt-ggacatgtatgtgtnnnnnnntacaggatactactgggaagtgttagcaactttgtgatgg |
273 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870628 |
aattatgtttatctatatttagtgtgatatttactttttggacatgtatgtataaaaaa-tacaggatactactgggaagtgttagcaactttgtgatgg |
23870530 |
T |
 |
| Q |
274 |
ttcactctccatgcccagtgactattgtgaagtattat |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23870529 |
ttcactctccatgcccagtgactattgtgaagtattat |
23870492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 23862459 - 23862418
Alignment:
| Q |
149 |
gtatgttcatctattgtcaaaataaaaattatgttcatctat |
190 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
23862459 |
gtatgttcatctcttgtcaaaataaaaagtatgttcatctat |
23862418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 305
Target Start/End: Complemental strand, 6276752 - 6276682
Alignment:
| Q |
235 |
acaggatactactgggaagtgttagcaactttgtgatggttcactctccatgcccagtgactattgtgaag |
305 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| | |||| ||||| ||||||||||||||| |
|
|
| T |
6276752 |
acaggatattactgggaagtgtaagcaactttgtgatgaccaatgctccttgccctgtgactattgtgaag |
6276682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University