View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4492_low_7 (Length: 243)
Name: NF4492_low_7
Description: NF4492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4492_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 3 - 125
Target Start/End: Original strand, 41640294 - 41640416
Alignment:
| Q |
3 |
catagggatatgaagtgtggaaacaaaaatatgacccacaattttacaacacactaaagaatttccattggtccatatataactcaaaactaaaaagtaa |
102 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41640294 |
catagggatatgaagtgtggtaacaaaaatatgacccacaattttacaacacactaaagaatttccattggtccatatataactcaaaactaaaaagtaa |
41640393 |
T |
|
| Q |
103 |
gggaaccacatttcagttggagg |
125 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
41640394 |
gggaaccacatttcagtttgagg |
41640416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University