View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4492_low_8 (Length: 242)
Name: NF4492_low_8
Description: NF4492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4492_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 227
Target Start/End: Original strand, 36893713 - 36893929
Alignment:
| Q |
11 |
cataggccctggaatgttctacatccatataatgcctccttccctgctgcaacagattaagctcaccggagttttggctaccaagaggctgcaaaatgtg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||| ||||||||||||||| ||||||||||| |
|
|
| T |
36893713 |
cataggccctggaatgttctacatccatataatgcctccttccctgctgcaacagatcaagctcgccagagtgttggctaccaagaggatgcaaaatgtg |
36893812 |
T |
 |
| Q |
111 |
accccgaccaagatcaggggcaacctcgtaattgtttggaatttgatgcatggctacaccatgagaagatgtaccaagttgtgtcatgggtgtcccgttg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36893813 |
accccgaccaagatcagggacaacctcgtaattgtttggaatttgatgcatggctacaccatgagaagatgtaccaagttgtgtcatgggtgtcccgttg |
36893912 |
T |
 |
| Q |
211 |
aaattcagcatgttatt |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36893913 |
aaattcagcatgttatt |
36893929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University