View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4493_high_23 (Length: 238)

Name: NF4493_high_23
Description: NF4493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4493_high_23
NF4493_high_23
[»] chr7 (1 HSPs)
chr7 (126-157)||(40396296-40396327)


Alignment Details
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 126 - 157
Target Start/End: Complemental strand, 40396327 - 40396296
Alignment:
126 gtttgagaggataaaaataagtcactataatt 157  Q
    ||||||||||||||||||||||||||||||||    
40396327 gtttgagaggataaaaataagtcactataatt 40396296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University