View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4493_low_18 (Length: 294)
Name: NF4493_low_18
Description: NF4493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4493_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 3123846 - 3124108
Alignment:
| Q |
19 |
gaatccctgcatgaagatgaaaattttcagctcgaatttgttgattgttatttggttcaaaaatttaattcaaaagggactaatatgatcaaaatatttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3123846 |
gaatccctgcatgaagatgaaaattttcagctcgaaattgttgattgttatttggttcaaaaatttaattcaaaagggactaatatgataaaaatatttc |
3123945 |
T |
|
| Q |
119 |
acaaactataagtaannnnnnnnnaattcataaattaaattttnnnnnnnnn--ttacaaattgagataattaatttctttaccgagcatatgatggaga |
216 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3123946 |
acaaattataagtaatttttttttaattcataaattaaatttaaaaaaaaaaaattacaaattgagataattaatttctttaccgagcatatgatggaga |
3124045 |
T |
|
| Q |
217 |
tcattgttatatcaggatttatcttccaagcactcaagtttggttctagcagtaagcatattg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3124046 |
tcattgttatatcaggatttatcttccaagcactcaagtttggttctagtagtaagcatattg |
3124108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University