View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4493_low_25 (Length: 240)
Name: NF4493_low_25
Description: NF4493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4493_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 36530035 - 36530256
Alignment:
| Q |
1 |
tttggctagctggttgcaatgataatgagtcattattatctattaagccattgaaaggttaaattagagcatggttgccaattgaggtaagaaagatttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36530035 |
tttggctagctggttgcaatgataatgagtcattattatctattgagccattgaaaggttaaattagagcatggttgccaattgaggtaagaaagatttt |
36530134 |
T |
 |
| Q |
101 |
cagacaatggcaactagaaagtaactaagatatttgattatgatttgaggaaaacatggtgagaaatggtatttgtcacgaatnnnnnnnntccacgaat |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36530135 |
cagacaatggcaaccagaaagtaactaagatatttgattataatttgaggaaaacatggtgagaaatggtatttgtcacgaataaaaaaaatccacgaat |
36530234 |
T |
 |
| Q |
201 |
gttttcacaaacaagaaaatgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36530235 |
gttttcacaaacaagaaaatgt |
36530256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University