View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4493_low_8 (Length: 392)
Name: NF4493_low_8
Description: NF4493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4493_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 103 - 336
Target Start/End: Original strand, 45889570 - 45889798
Alignment:
| Q |
103 |
agacatgtcaacaaatgctggtgacggcatttagaattagttatgttacgtgtttgnnnnnnnggacaaattacgtgtttgttttatctcacgttaatat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889570 |
agacatgtcaacaaatgctggtgacggcatttagaattagttatgttacgtgtttgtttttttggacaaattacgtgtttgttttatctcacgttaatat |
45889669 |
T |
 |
| Q |
203 |
atgctccaataacctcgannnnnnnnatggagaaagagaagaaaataaataaataagagaagccattgtcgcaaacttgtggaataaaactgctcataat |
302 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45889670 |
atgctccaataacctcga-attttttatggagaaagagaaga----aaaaaaataagagaagccattgtcgcaaacttgtggaataaaactgctcataat |
45889764 |
T |
 |
| Q |
303 |
ctcataaattttggattatacttaaattcacaag |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45889765 |
ctcataaattttggattatacttaaattcacaag |
45889798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University