View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4493_low_9 (Length: 368)
Name: NF4493_low_9
Description: NF4493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4493_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 70 - 290
Target Start/End: Complemental strand, 5154333 - 5154113
Alignment:
| Q |
70 |
acaaaaccctagcagcatagaagaaaaacccttaacagagaacaatggttaactaacctatgattaagaggagaagtatgatggaagaacagatcgtgca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5154333 |
acaaaaccctagcagcatagaagaaaaaccctaaatagagaacaatggttaactaacctatgattaagaggagaagtatgatggaagaacagatcgtgca |
5154234 |
T |
 |
| Q |
170 |
gagaatagagaagtaggcagggcttagagtggtggcaacttctgccgtgagagggaaccagagtgtgcagcaagtgagtgtaagggaaaggagagaggga |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5154233 |
gagaatagagaagtaggcagggcttagagtggtggcaacttctgccgtgagaaggaaccagagtgtgcagcaagtgagtgtaagggaaaggagagaggga |
5154134 |
T |
 |
| Q |
270 |
aacttatattttatactaata |
290 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5154133 |
aacttatattttatactaata |
5154113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 359
Target Start/End: Complemental strand, 5153769 - 5153720
Alignment:
| Q |
311 |
atactttctgtgaatgagcttttatacttca-ttaagtcccaacttcatc |
359 |
Q |
| |
|
||||||| |||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
5153769 |
atactttatgtgaaggggcttttatacttcagttaagtcccaacttcatc |
5153720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University