View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4494_low_2 (Length: 258)

Name: NF4494_low_2
Description: NF4494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4494_low_2
NF4494_low_2
[»] chr3 (18 HSPs)
chr3 (22-213)||(2659858-2660049)
chr3 (34-198)||(2501326-2501487)
chr3 (30-198)||(2491253-2491415)
chr3 (33-198)||(2645065-2645227)
chr3 (30-198)||(9562694-9562856)
chr3 (98-208)||(7334992-7335102)
chr3 (69-198)||(7443725-7443854)
chr3 (98-213)||(2475885-2476000)
chr3 (52-198)||(7325128-7325274)
chr3 (109-213)||(13497426-13497530)
chr3 (108-213)||(2630579-2630684)
chr3 (107-198)||(2474354-2474445)
chr3 (122-208)||(755353-755439)
chr3 (98-208)||(9566543-9566653)
chr3 (93-208)||(9595347-9595462)
chr3 (107-208)||(7398893-7398994)
chr3 (127-203)||(747851-747927)
chr3 (215-248)||(2659645-2659678)
[»] scaffold0097 (1 HSPs)
scaffold0097 (33-188)||(33827-33979)


Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 22 - 213
Target Start/End: Complemental strand, 2660049 - 2659858
Alignment:
22 tcactcgtggtggaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatc 121  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
2660049 tcactcgtggtggaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccagctcttccttttgatc 2659950  T
122 tcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttatctctgctcct 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||    
2659949 tcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttatttctgatcct 2659858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 34 - 198
Target Start/End: Original strand, 2501326 - 2501487
Alignment:
34 gaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcctgaga 133  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||   | ||| |||||| |||||| ||| |||||  |||||||||    
2501326 gaaacaaccaacactcagaggcagcgattggtcgccggaaccctaacatgcccaccg---ctggaacttccaactcttcttttcgatcttttgcctgaga 2501422  T
134 ttctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattct 198  Q
    ||||||| |||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||    
2501423 ttctgtgcaggcttccggtgaaattactagtacagcttcgatgcctttgtaagttcttcaattct 2501487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 30 - 198
Target Start/End: Original strand, 2491253 - 2491415
Alignment:
30 ggtggaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcct 129  Q
    |||||||||||||| |||||||| | | ||||   || ||||||||||||||||||||||    |||||||||||| |||||||||||||| ||||||||    
2491253 ggtggaaacaaccaccactcagaagaatcgat---ccaccggaaccctaacatgcccacca---ccggagcttccaactcttccttttgatgtcctgcct 2491346  T
130 gagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattct 198  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||    
2491347 gagattctgtgtaggcttccggtgaaattactggtacagcttcgatgcctttgtaagtttttcaattct 2491415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 33 - 198
Target Start/End: Complemental strand, 2645227 - 2645065
Alignment:
33 ggaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcctgag 132  Q
    |||||||||||||||||| |||| |||||||| |||||||||||||| || | |||||   | |||||||||| |||||||| |||||||||| ||||||    
2645227 ggaaacaaccaacactcaaaggcggcgattggtcgccggaaccctaaaatacacaccg---ctggagcttccaactcttcctgttgatctccttcctgag 2645131  T
133 attctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattct 198  Q
    ||||| |||||||||||||||||||||||  |||||||||||| |||||||||||| |||||||||    
2645130 attctttgtaggcttccggtgaaattacttatacagcttcgatacgtttgtaagttattcaattct 2645065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 30 - 198
Target Start/End: Complemental strand, 9562856 - 9562694
Alignment:
30 ggtggaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcct 129  Q
    |||||||||||||| |||||||||| ||||||   || ||||||||||||||||||||||    |||||||||||| |||||||||||||||| ||||||    
9562856 ggtggaaacaaccaccactcagaggaagcgat---ccaccggaaccctaacatgcccacca---ccggagcttccaactcttccttttgatcttctgcct 9562763  T
130 gagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattct 198  Q
    || ||||| ||||||||||||||||||||||| ||||||||||||||  | ||| |||| |||||||||    
9562762 gaaattctctgtaggcttccggtgaaattacttgtacagcttcgatgtctgtgtgagttcttcaattct 9562694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 98 - 208
Target Start/End: Complemental strand, 7335102 - 7334992
Alignment:
98 agcttccatctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattc 197  Q
    |||||||  ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||  | |||||||| || |||||    
7335102 agcttcctactcttccgtttgatgtcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgtctctgtaagttctttaattc 7335003  T
198 tcttatctctg 208  Q
    | |||||||||    
7335002 tgttatctctg 7334992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 69 - 198
Target Start/End: Complemental strand, 7443854 - 7443725
Alignment:
69 cggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacag 168  Q
    |||||||||||||| |||||||||||||||||||||  ||||||| || |||||||| ||||||||||| || |||||||| |||||||||||| ||||     
7443854 cggaaccctaacatacccaccggagccggagcttcccactcttcccttcgatctcctccctgagattctctgcaggcttcctgtgaaattactcatacaa 7443755  T
169 cttcgatgcgtttgtaagtttttcaattct 198  Q
    ||||| ||| | |||||||| |||||||||    
7443754 cttcggtgcctctgtaagttcttcaattct 7443725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 98 - 213
Target Start/End: Original strand, 2475885 - 2476000
Alignment:
98 agcttccatctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattc 197  Q
    |||||||  ||||||| |||||| |||||||||||||||||| |||| | || || |||||||||||||||||||| ||| |||||||||||||||||||    
2475885 agcttcccactcttccctttgatgtcctgcctgagattctgtttaggttacctgtcaaattactcgtacagcttcggtgcctttgtaagtttttcaattc 2475984  T
198 tcttatctctgctcct 213  Q
    |||||| |||| ||||    
2475985 tcttatttctgatcct 2476000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 52 - 198
Target Start/End: Complemental strand, 7325274 - 7325128
Alignment:
52 aggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcctgagattctgtgtaggcttccgg 151  Q
    ||||| ||||||  ||||||||||||||||| || |||   ||| ||||||||| |||||||||| ||| || | ||||||||||| || |||||||| |    
7325274 aggcaacgattgatcgccggaaccctaacattccaaccacggccagagcttccaactcttcctttcgatgtcttacctgagattctctgcaggcttcctg 7325175  T
152 tgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattct 198  Q
    ||||||||||| |||||||||| ||| | |||||||| |||||||||    
7325174 tgaaattactcatacagcttcggtgcctctgtaagttcttcaattct 7325128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 109 - 213
Target Start/End: Original strand, 13497426 - 13497530
Alignment:
109 cttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttatctctg 208  Q
    ||||| |||||||||||||||||||| || ||||||||||||||||| ||||| ||||| ||||||||| | || |||||||| |||||| | |||||||    
13497426 cttccatttgatctcctgcctgagatcctttgtaggcttccggtgaagttacttgtacaacttcgatgcctctgcaagttttttaattctttgatctctg 13497525  T
209 ctcct 213  Q
     ||||    
13497526 atcct 13497530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 108 - 213
Target Start/End: Original strand, 2630579 - 2630684
Alignment:
108 tcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttatctct 207  Q
    |||||| |||||| | ||| |||| ||||| |||| ||||||||||||||||||||| |||||||| ||| |||||||||| |||||||| ||||| |||    
2630579 tcttccgtttgatgttctgactgacattctctgtatgcttccggtgaaattactcgtgcagcttcggtgcctttgtaagttcttcaattcacttatttct 2630678  T
208 gctcct 213  Q
    | ||||    
2630679 gatcct 2630684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 107 - 198
Target Start/End: Original strand, 2474354 - 2474445
Alignment:
107 ctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattct 198  Q
    ||||||| ||||||||||||||||||||||| ||||||||||| || |||||||  ||||||||||| ||| | |||||||| || ||||||    
2474354 ctcttccctttgatctcctgcctgagattctctgtaggcttcccgtcaaattacctgtacagcttcggtgcctctgtaagttctttaattct 2474445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 122 - 208
Target Start/End: Complemental strand, 755439 - 755353
Alignment:
122 tcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttatctctg 208  Q
    |||||||||||||||| |||||||||||  | |||||||||| |||||| || ||| | ||||||| ||||||||||||||| ||||    
755439 tcctgcctgagattctttgtaggcttcccatcaaattactcggacagctgcggtgcctctgtaagtctttcaattctcttatttctg 755353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 98 - 208
Target Start/End: Complemental strand, 9566653 - 9566543
Alignment:
98 agcttccatctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattc 197  Q
    |||||||  ||||||| || ||| || ||||||||||||| |||||||||||  |||||||||||| ||||||||| ||| | || ||||  ||||||||    
9566653 agcttcctactcttcccttcgatgtcttgcctgagattctttgtaggcttcccatgaaattactcggacagcttcggtgcctctgcaagtccttcaattc 9566554  T
198 tcttatctctg 208  Q
    |||||| ||||    
9566553 tcttatttctg 9566543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 208
Target Start/End: Complemental strand, 9595462 - 9595347
Alignment:
93 gccggagcttccatctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttc 192  Q
    ||||||||||||| |||||||||| |||||  |  |||| ||||| || |||||||| ||||| || ||| | || ||||||||||| |||||||| ||     
9595462 gccggagcttccaactcttcctttcgatctaattgctgaaattctatgcaggcttcctgtgaagtttctctttcaacttcgatgcgtatgtaagttcttt 9595363  T
193 aattctcttatctctg 208  Q
     |||||||||| ||||    
9595362 cattctcttatttctg 9595347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 107 - 208
Target Start/End: Complemental strand, 7398994 - 7398893
Alignment:
107 ctcttccttttgatctcctgcctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttatctc 206  Q
    ||||||| || ||||||||| | ||||||||||||||||| || |||||  | ||| | || ||||||||| | |||||||| |||||| | ||||||||    
7398994 ctcttccattagatctcctgtcagagattctgtgtaggctcccagtgaagcttctccttcaacttcgatgcctctgtaagttcttcaatacccttatctc 7398895  T
207 tg 208  Q
    ||    
7398894 tg 7398893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 203
Target Start/End: Complemental strand, 747927 - 747851
Alignment:
127 cctgagattctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtttttcaattctcttat 203  Q
    |||||| ||||  ||||||||||  | |||||||||||||| ||||||||| | |||||||||||  ||||||||||    
747927 cctgagtttctcggtaggcttcccatcaaattactcgtacaacttcgatgcctctgtaagtttttttattctcttat 747851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 248
Target Start/End: Complemental strand, 2659678 - 2659645
Alignment:
215 cacaaatggacattactgcatcgacctgatgatg 248  Q
    ||||||||||||| ||||||||||||||||||||    
2659678 cacaaatggacatcactgcatcgacctgatgatg 2659645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0097 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: scaffold0097
Description:

Target: scaffold0097; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 33 - 188
Target Start/End: Original strand, 33827 - 33979
Alignment:
33 ggaaacaaccaacactcagaggcagcgattggccgccggaaccctaacatgcccaccggagccggagcttccatctcttccttttgatctcctgcctgag 132  Q
    |||||||||||| ||||| || |||||||||||| ||||||||||||||| |||||||   |||||||||||| ||||||||||||||||| | ||||||    
33827 ggaaacaaccaatactcaaagacagcgattggccaccggaaccctaacatacccaccg---ccggagcttccaactcttccttttgatctcatacctgag 33923  T
133 attctgtgtaggcttccggtgaaattactcgtacagcttcgatgcgtttgtaagtt 188  Q
    ||||| |||||||||||||| ||||||||| |||| || |||||| | ||||||||    
33924 attctatgtaggcttccggtcaaattactcatacaactccgatgcctctgtaagtt 33979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University