View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4495_high_6 (Length: 271)
Name: NF4495_high_6
Description: NF4495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4495_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Original strand, 2011013 - 2011209
Alignment:
| Q |
13 |
tgagatatacattaagtgcccatatcccatgtttgttttgctatccaattcttgtggggtttgatcgctggatgaaggtgtgatttgatacatgctaggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2011013 |
tgagatatacattaagtgcccatatcccatgtttgttttgctatccaattcttgtggggtttgatcgctggatgaaggtgtgatttgatacatgctaggt |
2011112 |
T |
 |
| Q |
113 |
tacaaaacaaccgaaccaaataacactttcagcccataattgtgtttctttctgatcatgttggttttcagttaggaaaattcaaataatttttatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2011113 |
tacaaaacaaccgaaccaaataacactttcagcccataattgtgtttctttctgatcatgttggttttcagttaggaaaattcaaataatttctatt |
2011209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University