View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4495_high_7 (Length: 250)
Name: NF4495_high_7
Description: NF4495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4495_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 1936223 - 1935991
Alignment:
| Q |
1 |
tttattttataccattataacttaatttaaatttttgtagcttcgcaagtttttccatgagaatagcagaattgattttacgcctaagtttaggggagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936223 |
tttattttataccattataacttaatttacatttttgtagcttcgcaagtttttccatgagaatagcagaattgattttacgcctaagtttaggggagtt |
1936124 |
T |
 |
| Q |
101 |
ttacatcaaatttttaattcatgtgaccttgacgcgaatggtggccttaactttgcataattaagtcgttttcaggttaatttttctattgcatgtttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1936123 |
ttacatcaaatttttaattcatgtgaccttgacgcggatggtggccttaactttgcacaattaagtcgttttcaggttaatttttctattgcatgtttat |
1936024 |
T |
 |
| Q |
201 |
tattgaagtacaccatttagctttgatattcct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1936023 |
tattgaagtacaccatttagctttgatattcct |
1935991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University