View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4495_low_11 (Length: 240)
Name: NF4495_low_11
Description: NF4495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4495_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 108 - 221
Target Start/End: Complemental strand, 37227069 - 37226956
Alignment:
| Q |
108 |
ctaatcaattaactaaacgatattaggttaagactaaccatcactgtcgtcatcagcgttattgctacttccaccgggagaaggagaaccaatcggttgc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227069 |
ctaatcaattaactaaacgatattaggttaagactaaccatcactgtcgtcatcagcgttattgctacttccaccgggagaaggagaaccaatcggttgc |
37226970 |
T |
|
| Q |
208 |
aggaaggagttccg |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37226969 |
aggaaggagttccg |
37226956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 37227176 - 37227110
Alignment:
| Q |
1 |
cggaatctgataaacgttccggtttaatgaaatccgtcgatacaggaccacgaaattcgtcatctgc |
67 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37227176 |
cggaatctgatagccgttccggtttaatgaaatccgtcgatacaggaccacgaaattcgtcatctgc |
37227110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University