View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4495_low_12 (Length: 240)
Name: NF4495_low_12
Description: NF4495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4495_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 45313804 - 45314044
Alignment:
| Q |
1 |
acatttttctccaaagaaacaaacccaaatttcaatttttgcataggagccttatcaacatta-----------------tccaaaatgctaaaatcatc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45313804 |
acatttttctccaaagaaacaaacccaaatttcaattttttcataggagccttatcaacattagaaattgccctatcctatccaaaatgctaaaatcatc |
45313903 |
T |
 |
| Q |
84 |
aggatttatctcaggaaactcactgagaagcatcaacaacatcaatgacggaagatggaagcggtgggtcatccggcggagtgtgaaaaacgtcttggtt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313904 |
cggatttatctcaggaaactcactgagaagcatcaacaacatcaatgacggaagatggaagcggtgggtcatccggcggagtgtgaaaaacgtcttggtt |
45314003 |
T |
 |
| Q |
184 |
atcgacgtgctgggtgtctggagcggacaagaggatgacgg |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45314004 |
atcgacgtgctgggtgtctggagcggacaagaggatgacgg |
45314044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 124 - 213
Target Start/End: Complemental strand, 54631353 - 54631264
Alignment:
| Q |
124 |
atcaatgacggaagatggaagcggtgggtcatccggcggagtgtgaaaaacgtcttggttatcgacgtgctgggtgtctggagcggacaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
54631353 |
atcaatgacggaagatggaagcggtgggtcctccggcggagtgtgaaaaacgtcttggttatcgacgtgctgggtgtctggagcgtacaa |
54631264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University