View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4496-Insertion-11 (Length: 325)
Name: NF4496-Insertion-11
Description: NF4496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4496-Insertion-11 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 145 - 325
Target Start/End: Original strand, 527249 - 527430
Alignment:
| Q |
145 |
ttgctccatattttttgaacttggtttt-gtcatcagtttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcggactgg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527249 |
ttgctccatattttttgaacttggtttttgtcatcagcttcttcaagcagtgtcctaatcctaatgatgctcagagaagagagctgagccttcggactgg |
527348 |
T |
|
| Q |
244 |
gttagacccaacgcaaatcaagttttggtttcagaacaggcgcacttcactcaaggtaattttgaccaactaactacatgta |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
527349 |
gttagacccaacgcaaatcaagttttggtttcagaacaggcgcacttcactgaaggtaactttgaccaactaactacatgta |
527430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 2 - 86
Target Start/End: Original strand, 527104 - 527188
Alignment:
| Q |
2 |
ccaacaatccaaccaacgtcgcagaaaaaggacatatcgccgccacacacagcaacaaattgatgaaatggatacgtaggaacca |
86 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
527104 |
ccaagaatccaaccaacgtcgcagaaaaaggacatatcgccgccacacacagcaacaaattgatgaaatggatacgtaggaacca |
527188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University