View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4496-Insertion-15 (Length: 194)
Name: NF4496-Insertion-15
Description: NF4496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4496-Insertion-15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 8 - 117
Target Start/End: Complemental strand, 41162264 - 41162155
Alignment:
| Q |
8 |
atgagaaggtgacgaaggcgcgagagtgccattgaagagaatcaaaatcgcaagtgtgctgattgattcgattgttgaatgtaaaaagaaaagaagagga |
107 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41162264 |
atgagagggtgacgaaggcgcgagagtgccattgaagagaatcaaaatcgcaagtgtgttgattgattcgattgttgaatgtaaaaagaaaagaagagaa |
41162165 |
T |
 |
| Q |
108 |
aagagggttg |
117 |
Q |
| |
|
|||||||||| |
|
|
| T |
41162164 |
aagagggttg |
41162155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 135 - 192
Target Start/End: Complemental strand, 41162143 - 41162079
Alignment:
| Q |
135 |
gattagcacataattttcaataatcattcatc-------attacttggtggtaggttaggttttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41162143 |
gattagcacataattttcaataatcattcatcattattcattacttggtggtaggttaggttttt |
41162079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University