View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4496-Insertion-9 (Length: 493)
Name: NF4496-Insertion-9
Description: NF4496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4496-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 462; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 462; E-Value: 0
Query Start/End: Original strand, 8 - 493
Target Start/End: Complemental strand, 39020108 - 39019623
Alignment:
| Q |
8 |
acttttactctaattataacaaatacatcaaaaccatatagttgtggctactacaaggagattgccttcagattcaggagcttttgctgattgggcacca |
107 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39020108 |
acttttactctaattataacaaatatatcaaaaccatatagttgtggctactacaaggagattgccttcagattcaggagcttttgctgattgggcacca |
39020009 |
T |
 |
| Q |
108 |
actaattcatcaacagcccttcgtgctgctgctgctccagaagatctttctctcggtttcaatgcggctcccaccgccggaaacgccggagcttccaccg |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39020008 |
actaattcatcaacaacccttcgtgctgctgctgctccagaagatctttctctcggtttcaatgcggctcccaccgccggaaacgccggaccttccaccg |
39019909 |
T |
 |
| Q |
208 |
gacccaccaccggattatataattcatctaggtccattaattatggacctgagatgggtatgtttgttgtagcaccttcttcttttcatcaccaccacca |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39019908 |
gacccaccaccggattatataattcatctaggtccattaattatggacctgagatgggtatgtttgttgtagcaccttcttcttttcatcatcaccacca |
39019809 |
T |
 |
| Q |
308 |
taataacaaccaccatgaagctcttatgtctgatcctcactctcttaaccccgccaccgctctcggtgtcggggttatacctttactcacagcttctcca |
407 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39019808 |
taataacaaccaccatgaagctctcatgtctgatcctcactctcttaaccccgccaccgctctcggtgttggggttatacctttactcacagcttctcca |
39019709 |
T |
 |
| Q |
408 |
tgtcttgaaaatgaaaacatgttaaacagtagaagaaaccaacaaggaattcagttttggcatgaacaacatcatcaacaacagca |
493 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39019708 |
tgtcttgaaaatgaaaacatgttaaacagtagaagaaaccaacaaggaattcagttttggcatgaacaacatcatcaacaacagca |
39019623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University