View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4496_low_11 (Length: 267)
Name: NF4496_low_11
Description: NF4496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4496_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 250
Target Start/End: Complemental strand, 48312737 - 48312488
Alignment:
| Q |
1 |
aaactcgacaacaggtttcttcttcacactactcttgtatcaacatgtcatgtgctattatgcgttatgaaggttttagaggtttttataaaggttttgg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48312737 |
aaactcgacaacaggtttcttcttcacactactcttgtatcaacatgtcatgtgctattatgcgttacgaaggttttagaggtttttataaaggttttgg |
48312638 |
T |
 |
| Q |
101 |
tacttctttaatgggtactatccctgctagagcactttatatgacagcacttgaagttactaagagtaacgttggtactgcttttgttgaattgggtttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48312637 |
tacttctttaatgggtactatccctgctagagcactttatatgacagcacttgaagttactaagagtaacgttggtactgcttttgttgaattgggtttt |
48312538 |
T |
 |
| Q |
201 |
tctgataatactgccactgctgtggctagtgctgctgctggtgttgcttc |
250 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48312537 |
tctgataatactgctactgctgtggctagtgctgctgctggtgttgcttc |
48312488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University