View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4496_low_9 (Length: 303)
Name: NF4496_low_9
Description: NF4496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4496_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 129 - 284
Target Start/End: Original strand, 34879994 - 34880167
Alignment:
| Q |
129 |
ggcattgtcttctattattaatgtactacatggtacaagtgtaacactaataataagcaatcaaaatcagcttgccaatgcga----------------- |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
34879994 |
ggcattgtcttctattattaatgtactacatggtacaagtgtaacactaataataagcaatcaaaatcagcttgccaatgtgatttgatttctattggtg |
34880093 |
T |
|
| Q |
212 |
-tttgatttctcagaacaaaatcattggcatacaatatgagcgaattccccatcacagtaactgctgataggta |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34880094 |
ttttgatttctcagaacaaaatcattggcatacaatatgagcgaattccccatcacaataactgctgataggta |
34880167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 17 - 86
Target Start/End: Complemental strand, 39832411 - 39832342
Alignment:
| Q |
17 |
aatatgagccttgaattcacttagcctctcttgttggacttattcaccttaggttttacggcggtcccaa |
86 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
39832411 |
aatatgagccttgaatttacttagcctctcttgttggacttattcatcttaggttttatggcggtcccaa |
39832342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University