View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4497-Insertion-14 (Length: 125)
Name: NF4497-Insertion-14
Description: NF4497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4497-Insertion-14 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 3e-49; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 3e-49
Query Start/End: Original strand, 8 - 125
Target Start/End: Original strand, 40898844 - 40898964
Alignment:
| Q |
8 |
gtatgtacgattttatttttatttgtttgctcataaaatgaacttaat---attcaattatggatcaacatgcgtagggcttagccacaaccattcttat |
104 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40898844 |
gtatgtatgattttatttttatttgtttgctcataaaatgaacttaataatattcaattatggatcaacatgagtagggcttagccacaaccattcttat |
40898943 |
T |
|
| Q |
105 |
taattctgcaagcaattatga |
125 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40898944 |
taattctgcaagcaattatga |
40898964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University