View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4497-Insertion-9 (Length: 548)
Name: NF4497-Insertion-9
Description: NF4497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4497-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 6e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 6e-94
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 11198698 - 11198900
Alignment:
| Q |
8 |
tcaaccaaatgagttatccatcctcatttcccataaatatttatactctaagatatgtccgaataaaaaatcgataaattattccaaaaggaccaaaagc |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11198698 |
tcaaccaagtgagttatccatcctcatttcccataaatatttatactctaagatatgtccgaataaaaaatcgataaattattccaaaaggaccaaaagc |
11198797 |
T |
 |
| Q |
108 |
atccatgttagtactaatgtacttttgctgcatatattgtaacaaaataaataaattgcaaatttatttttaaaagattaatttttatgcactggtggtg |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11198798 |
atccat-atagtactaatgtacttttgctgc--atattgtaacaaaataaataaattgcaaatttatttttaaaagattaatttttatgcaccggtggtg |
11198894 |
T |
 |
| Q |
208 |
taattt |
213 |
Q |
| |
|
|||||| |
|
|
| T |
11198895 |
taattt |
11198900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University